Review



dr yi zhang  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc dr yi zhang
    Dr Yi Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yi+zhang/pcDNA-Flag-Tet3+(Plasmid+%2360940)/pmc12310658-89-11-15
    Average 91 stars, based on 5 article reviews
    dr yi zhang - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    DNA Methylation Assay:

    Article Title: Cell-specific exon methylation and CTCF binding in neurons regulate calcium ion channel splicing and function
    Article Snippet: .. Genomic DNA methylation and hydroxyl-methylation ELISAs Genomic DNA methylation and hydroxyl-methylation ELISAs gDNA was extracted from F11 cells using QIAamp DNA Mini Kit (QIAGEN Cat# 51304) and global DNA methylation (5-mC) and hydroxyl-methylation (5-hmC) levels were measured by ELISA assays (MethylFlash Methylated DNA 5-mC Quantification Kit - EpiGentek Cat# P-1030; MethylFlash Global DNA Hydroxymethylation 5- hmC ELISA Easy Kit - EpiGentek Cat# P-1032) according to manufacturer’s protocols. cDNA plasmids and siRNAs cDNA plasmids and siRNAs cDNA plasmid expression vectors are listed in Key Resources Table. pcDNA3-Tet1 (Addgene plasmid # 60938; http://n2t.net/addgene:60938; RRID:Addgene_60938), pcDNA3-Tet2 (Addgene plasmid # 60939; http://n2t.net/addgene:60939; RRID:Addgene_60939), and pcDNA-Flag-Tet3 were gifts from Yi Zhang (Addgene plasmid # 60940; http://n2t.net/addgene:60940; RRID:Addgene_60940) (Wang and Zhang, 2014). .. Fuw-dCas9-Tet1CD (Addgene plasmid # 84475; http://n2t.net/addgene:84475; RRID:Addgene_84475) and pgRNA-modified were gifts from Rudolf Jaenisch (Addgene plasmid # 84477; http://n2t.net/addgene:84477; RRID:Addgene_ 84477) (Liu et al., 2016).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Cell-specific exon methylation and CTCF binding in neurons regulate calcium ion channel splicing and function
    Article Snippet: .. Genomic DNA methylation and hydroxyl-methylation ELISAs Genomic DNA methylation and hydroxyl-methylation ELISAs gDNA was extracted from F11 cells using QIAamp DNA Mini Kit (QIAGEN Cat# 51304) and global DNA methylation (5-mC) and hydroxyl-methylation (5-hmC) levels were measured by ELISA assays (MethylFlash Methylated DNA 5-mC Quantification Kit - EpiGentek Cat# P-1030; MethylFlash Global DNA Hydroxymethylation 5- hmC ELISA Easy Kit - EpiGentek Cat# P-1032) according to manufacturer’s protocols. cDNA plasmids and siRNAs cDNA plasmids and siRNAs cDNA plasmid expression vectors are listed in Key Resources Table. pcDNA3-Tet1 (Addgene plasmid # 60938; http://n2t.net/addgene:60938; RRID:Addgene_60938), pcDNA3-Tet2 (Addgene plasmid # 60939; http://n2t.net/addgene:60939; RRID:Addgene_60939), and pcDNA-Flag-Tet3 were gifts from Yi Zhang (Addgene plasmid # 60940; http://n2t.net/addgene:60940; RRID:Addgene_60940) (Wang and Zhang, 2014). .. Fuw-dCas9-Tet1CD (Addgene plasmid # 84475; http://n2t.net/addgene:84475; RRID:Addgene_84475) and pgRNA-modified were gifts from Rudolf Jaenisch (Addgene plasmid # 84477; http://n2t.net/addgene:84477; RRID:Addgene_ 84477) (Liu et al., 2016).

    Methylation:

    Article Title: Cell-specific exon methylation and CTCF binding in neurons regulate calcium ion channel splicing and function
    Article Snippet: .. Genomic DNA methylation and hydroxyl-methylation ELISAs Genomic DNA methylation and hydroxyl-methylation ELISAs gDNA was extracted from F11 cells using QIAamp DNA Mini Kit (QIAGEN Cat# 51304) and global DNA methylation (5-mC) and hydroxyl-methylation (5-hmC) levels were measured by ELISA assays (MethylFlash Methylated DNA 5-mC Quantification Kit - EpiGentek Cat# P-1030; MethylFlash Global DNA Hydroxymethylation 5- hmC ELISA Easy Kit - EpiGentek Cat# P-1032) according to manufacturer’s protocols. cDNA plasmids and siRNAs cDNA plasmids and siRNAs cDNA plasmid expression vectors are listed in Key Resources Table. pcDNA3-Tet1 (Addgene plasmid # 60938; http://n2t.net/addgene:60938; RRID:Addgene_60938), pcDNA3-Tet2 (Addgene plasmid # 60939; http://n2t.net/addgene:60939; RRID:Addgene_60939), and pcDNA-Flag-Tet3 were gifts from Yi Zhang (Addgene plasmid # 60940; http://n2t.net/addgene:60940; RRID:Addgene_60940) (Wang and Zhang, 2014). .. Fuw-dCas9-Tet1CD (Addgene plasmid # 84475; http://n2t.net/addgene:84475; RRID:Addgene_84475) and pgRNA-modified were gifts from Rudolf Jaenisch (Addgene plasmid # 84477; http://n2t.net/addgene:84477; RRID:Addgene_ 84477) (Liu et al., 2016).

    Plasmid Preparation:

    Article Title: Cell-specific exon methylation and CTCF binding in neurons regulate calcium ion channel splicing and function
    Article Snippet: .. Genomic DNA methylation and hydroxyl-methylation ELISAs Genomic DNA methylation and hydroxyl-methylation ELISAs gDNA was extracted from F11 cells using QIAamp DNA Mini Kit (QIAGEN Cat# 51304) and global DNA methylation (5-mC) and hydroxyl-methylation (5-hmC) levels were measured by ELISA assays (MethylFlash Methylated DNA 5-mC Quantification Kit - EpiGentek Cat# P-1030; MethylFlash Global DNA Hydroxymethylation 5- hmC ELISA Easy Kit - EpiGentek Cat# P-1032) according to manufacturer’s protocols. cDNA plasmids and siRNAs cDNA plasmids and siRNAs cDNA plasmid expression vectors are listed in Key Resources Table. pcDNA3-Tet1 (Addgene plasmid # 60938; http://n2t.net/addgene:60938; RRID:Addgene_60938), pcDNA3-Tet2 (Addgene plasmid # 60939; http://n2t.net/addgene:60939; RRID:Addgene_60939), and pcDNA-Flag-Tet3 were gifts from Yi Zhang (Addgene plasmid # 60940; http://n2t.net/addgene:60940; RRID:Addgene_60940) (Wang and Zhang, 2014). .. Fuw-dCas9-Tet1CD (Addgene plasmid # 84475; http://n2t.net/addgene:84475; RRID:Addgene_84475) and pgRNA-modified were gifts from Rudolf Jaenisch (Addgene plasmid # 84477; http://n2t.net/addgene:84477; RRID:Addgene_ 84477) (Liu et al., 2016).

    Article Title: B-type Plexins promote the GTPase activity of Ran to affect androgen receptor nuclear translocation in prostate cancer.
    Article Snippet: .. Expression vectors and site-directed mutagenesis pcDNA3-PlexinB1 full-length-myc (PlexinB1-myc), pcDNA3-Plexin B1 cytoplasmic domain-Myc (cytoPlexinB1-myc), PlexinB1(RA)-myc (R1677A, R1678A, R1984A) and cytoPlexinB1(RA)-myc were kind gifts of Dr I Oinuma (Kyoto, Japan). pmCherry-C1-RanQ69L was a gift from Jay Brenman (Addgene plasmid # 30309; http://n2t.net/addgene:30309; RRID:Addgene_30309), Cancer Gene Therapy (2023) 30:1513 – 1523 pcDNA-Ran-T24N-Mrfp1-polyA from Yi Zhang (Addgene plasmid # 104561; http://n2t.net/addgene:104561; RRID:Addgene_104561), pcDNA-RanWTMrfp1-polyA from Yi Zhang (Addgene plasmid # 59750; http://n2t.net/ addgene:59750; RRID:Addgene_59750), GFP-RelA from Warner Greene (Addgene plasmid # 23255; http://n2t.net/addgene:23255; RRID:Addgene_23255) [51–53], Px-RCC1-HA from Patrizia Lavia (Addgene plasmid # 106938; http://n2t.net/addgene:106938; RRID:Addgene_106938) [54]. pGex-GST-cytoPlexinB1, pGex-GST-cytoPlexinB2 and pGex-GSTcytoPlexinB3 were generated by subcloning from the corresponding full-length Plexin pcDNA3 plasmids using NEBuilder® HiFi DNA Assembly Master Mix (E2621S NEB), using the primers: pGex-GSTcytoPlexinB1: ATCGGATCTGGTTCCGCGTGGCAGGAGGAAGAGCAAGCAG and GTCAGTCACGA TGCGGCCGCTCCTATAGATCTGTGACCTTGTTTTC; pGex-GST-cytoPlexinB2: ATCGGATCTGG TTCCGCGTGGGTGCTACTGGAGG AAGAGC and GTCA GTCACGATGCGGCCGCTCAGTGAC CTTGTTCTCCAG; pGex-GST-cytoPlexinB3: ATCGGATCTGGTTCCGCGTGGGAGGCACAAGA GCAAGCAG and GTCA GTCACGATGCGGCCGCTCTCACAGGTCAGTCACTTTG. ..

    Article Title: iPS cell generation-associated point mutations include many C > T substitutions via different cytosine modification mechanisms.
    Article Snippet: All animal procedures were approved by the Ethics Committee of the National Institutes for Quantum Science and Technology. .. Plasmid Construction and mouse iPSCs generation pMXs- Oct3/4, -Sox2, -Klf4 and -c-Myc were gifts from Shinya Yamanaka (Addgene plasmid # 13366, #13367, #13370 and #13375)1. pcDNA3-Tet1 and pcDNA3-Tet2 were gifts from Yi Zhang (Addgene plasmid # 60938, #60939)47. ..

    Expressing:

    Article Title: Cell-specific exon methylation and CTCF binding in neurons regulate calcium ion channel splicing and function
    Article Snippet: .. Genomic DNA methylation and hydroxyl-methylation ELISAs Genomic DNA methylation and hydroxyl-methylation ELISAs gDNA was extracted from F11 cells using QIAamp DNA Mini Kit (QIAGEN Cat# 51304) and global DNA methylation (5-mC) and hydroxyl-methylation (5-hmC) levels were measured by ELISA assays (MethylFlash Methylated DNA 5-mC Quantification Kit - EpiGentek Cat# P-1030; MethylFlash Global DNA Hydroxymethylation 5- hmC ELISA Easy Kit - EpiGentek Cat# P-1032) according to manufacturer’s protocols. cDNA plasmids and siRNAs cDNA plasmids and siRNAs cDNA plasmid expression vectors are listed in Key Resources Table. pcDNA3-Tet1 (Addgene plasmid # 60938; http://n2t.net/addgene:60938; RRID:Addgene_60938), pcDNA3-Tet2 (Addgene plasmid # 60939; http://n2t.net/addgene:60939; RRID:Addgene_60939), and pcDNA-Flag-Tet3 were gifts from Yi Zhang (Addgene plasmid # 60940; http://n2t.net/addgene:60940; RRID:Addgene_60940) (Wang and Zhang, 2014). .. Fuw-dCas9-Tet1CD (Addgene plasmid # 84475; http://n2t.net/addgene:84475; RRID:Addgene_84475) and pgRNA-modified were gifts from Rudolf Jaenisch (Addgene plasmid # 84477; http://n2t.net/addgene:84477; RRID:Addgene_ 84477) (Liu et al., 2016).

    Article Title: B-type Plexins promote the GTPase activity of Ran to affect androgen receptor nuclear translocation in prostate cancer.
    Article Snippet: .. Expression vectors and site-directed mutagenesis pcDNA3-PlexinB1 full-length-myc (PlexinB1-myc), pcDNA3-Plexin B1 cytoplasmic domain-Myc (cytoPlexinB1-myc), PlexinB1(RA)-myc (R1677A, R1678A, R1984A) and cytoPlexinB1(RA)-myc were kind gifts of Dr I Oinuma (Kyoto, Japan). pmCherry-C1-RanQ69L was a gift from Jay Brenman (Addgene plasmid # 30309; http://n2t.net/addgene:30309; RRID:Addgene_30309), Cancer Gene Therapy (2023) 30:1513 – 1523 pcDNA-Ran-T24N-Mrfp1-polyA from Yi Zhang (Addgene plasmid # 104561; http://n2t.net/addgene:104561; RRID:Addgene_104561), pcDNA-RanWTMrfp1-polyA from Yi Zhang (Addgene plasmid # 59750; http://n2t.net/ addgene:59750; RRID:Addgene_59750), GFP-RelA from Warner Greene (Addgene plasmid # 23255; http://n2t.net/addgene:23255; RRID:Addgene_23255) [51–53], Px-RCC1-HA from Patrizia Lavia (Addgene plasmid # 106938; http://n2t.net/addgene:106938; RRID:Addgene_106938) [54]. pGex-GST-cytoPlexinB1, pGex-GST-cytoPlexinB2 and pGex-GSTcytoPlexinB3 were generated by subcloning from the corresponding full-length Plexin pcDNA3 plasmids using NEBuilder® HiFi DNA Assembly Master Mix (E2621S NEB), using the primers: pGex-GSTcytoPlexinB1: ATCGGATCTGGTTCCGCGTGGCAGGAGGAAGAGCAAGCAG and GTCAGTCACGA TGCGGCCGCTCCTATAGATCTGTGACCTTGTTTTC; pGex-GST-cytoPlexinB2: ATCGGATCTGG TTCCGCGTGGGTGCTACTGGAGG AAGAGC and GTCA GTCACGATGCGGCCGCTCAGTGAC CTTGTTCTCCAG; pGex-GST-cytoPlexinB3: ATCGGATCTGGTTCCGCGTGGGAGGCACAAGA GCAAGCAG and GTCA GTCACGATGCGGCCGCTCTCACAGGTCAGTCACTTTG. ..

    Mutagenesis:

    Article Title: B-type Plexins promote the GTPase activity of Ran to affect androgen receptor nuclear translocation in prostate cancer.
    Article Snippet: .. Expression vectors and site-directed mutagenesis pcDNA3-PlexinB1 full-length-myc (PlexinB1-myc), pcDNA3-Plexin B1 cytoplasmic domain-Myc (cytoPlexinB1-myc), PlexinB1(RA)-myc (R1677A, R1678A, R1984A) and cytoPlexinB1(RA)-myc were kind gifts of Dr I Oinuma (Kyoto, Japan). pmCherry-C1-RanQ69L was a gift from Jay Brenman (Addgene plasmid # 30309; http://n2t.net/addgene:30309; RRID:Addgene_30309), Cancer Gene Therapy (2023) 30:1513 – 1523 pcDNA-Ran-T24N-Mrfp1-polyA from Yi Zhang (Addgene plasmid # 104561; http://n2t.net/addgene:104561; RRID:Addgene_104561), pcDNA-RanWTMrfp1-polyA from Yi Zhang (Addgene plasmid # 59750; http://n2t.net/ addgene:59750; RRID:Addgene_59750), GFP-RelA from Warner Greene (Addgene plasmid # 23255; http://n2t.net/addgene:23255; RRID:Addgene_23255) [51–53], Px-RCC1-HA from Patrizia Lavia (Addgene plasmid # 106938; http://n2t.net/addgene:106938; RRID:Addgene_106938) [54]. pGex-GST-cytoPlexinB1, pGex-GST-cytoPlexinB2 and pGex-GSTcytoPlexinB3 were generated by subcloning from the corresponding full-length Plexin pcDNA3 plasmids using NEBuilder® HiFi DNA Assembly Master Mix (E2621S NEB), using the primers: pGex-GSTcytoPlexinB1: ATCGGATCTGGTTCCGCGTGGCAGGAGGAAGAGCAAGCAG and GTCAGTCACGA TGCGGCCGCTCCTATAGATCTGTGACCTTGTTTTC; pGex-GST-cytoPlexinB2: ATCGGATCTGG TTCCGCGTGGGTGCTACTGGAGG AAGAGC and GTCA GTCACGATGCGGCCGCTCAGTGAC CTTGTTCTCCAG; pGex-GST-cytoPlexinB3: ATCGGATCTGGTTCCGCGTGGGAGGCACAAGA GCAAGCAG and GTCA GTCACGATGCGGCCGCTCTCACAGGTCAGTCACTTTG. ..

    Generated:

    Article Title: B-type Plexins promote the GTPase activity of Ran to affect androgen receptor nuclear translocation in prostate cancer.
    Article Snippet: .. Expression vectors and site-directed mutagenesis pcDNA3-PlexinB1 full-length-myc (PlexinB1-myc), pcDNA3-Plexin B1 cytoplasmic domain-Myc (cytoPlexinB1-myc), PlexinB1(RA)-myc (R1677A, R1678A, R1984A) and cytoPlexinB1(RA)-myc were kind gifts of Dr I Oinuma (Kyoto, Japan). pmCherry-C1-RanQ69L was a gift from Jay Brenman (Addgene plasmid # 30309; http://n2t.net/addgene:30309; RRID:Addgene_30309), Cancer Gene Therapy (2023) 30:1513 – 1523 pcDNA-Ran-T24N-Mrfp1-polyA from Yi Zhang (Addgene plasmid # 104561; http://n2t.net/addgene:104561; RRID:Addgene_104561), pcDNA-RanWTMrfp1-polyA from Yi Zhang (Addgene plasmid # 59750; http://n2t.net/ addgene:59750; RRID:Addgene_59750), GFP-RelA from Warner Greene (Addgene plasmid # 23255; http://n2t.net/addgene:23255; RRID:Addgene_23255) [51–53], Px-RCC1-HA from Patrizia Lavia (Addgene plasmid # 106938; http://n2t.net/addgene:106938; RRID:Addgene_106938) [54]. pGex-GST-cytoPlexinB1, pGex-GST-cytoPlexinB2 and pGex-GSTcytoPlexinB3 were generated by subcloning from the corresponding full-length Plexin pcDNA3 plasmids using NEBuilder® HiFi DNA Assembly Master Mix (E2621S NEB), using the primers: pGex-GSTcytoPlexinB1: ATCGGATCTGGTTCCGCGTGGCAGGAGGAAGAGCAAGCAG and GTCAGTCACGA TGCGGCCGCTCCTATAGATCTGTGACCTTGTTTTC; pGex-GST-cytoPlexinB2: ATCGGATCTGG TTCCGCGTGGGTGCTACTGGAGG AAGAGC and GTCA GTCACGATGCGGCCGCTCAGTGAC CTTGTTCTCCAG; pGex-GST-cytoPlexinB3: ATCGGATCTGGTTCCGCGTGGGAGGCACAAGA GCAAGCAG and GTCA GTCACGATGCGGCCGCTCTCACAGGTCAGTCACTTTG. ..

    Subcloning:

    Article Title: B-type Plexins promote the GTPase activity of Ran to affect androgen receptor nuclear translocation in prostate cancer.
    Article Snippet: .. Expression vectors and site-directed mutagenesis pcDNA3-PlexinB1 full-length-myc (PlexinB1-myc), pcDNA3-Plexin B1 cytoplasmic domain-Myc (cytoPlexinB1-myc), PlexinB1(RA)-myc (R1677A, R1678A, R1984A) and cytoPlexinB1(RA)-myc were kind gifts of Dr I Oinuma (Kyoto, Japan). pmCherry-C1-RanQ69L was a gift from Jay Brenman (Addgene plasmid # 30309; http://n2t.net/addgene:30309; RRID:Addgene_30309), Cancer Gene Therapy (2023) 30:1513 – 1523 pcDNA-Ran-T24N-Mrfp1-polyA from Yi Zhang (Addgene plasmid # 104561; http://n2t.net/addgene:104561; RRID:Addgene_104561), pcDNA-RanWTMrfp1-polyA from Yi Zhang (Addgene plasmid # 59750; http://n2t.net/ addgene:59750; RRID:Addgene_59750), GFP-RelA from Warner Greene (Addgene plasmid # 23255; http://n2t.net/addgene:23255; RRID:Addgene_23255) [51–53], Px-RCC1-HA from Patrizia Lavia (Addgene plasmid # 106938; http://n2t.net/addgene:106938; RRID:Addgene_106938) [54]. pGex-GST-cytoPlexinB1, pGex-GST-cytoPlexinB2 and pGex-GSTcytoPlexinB3 were generated by subcloning from the corresponding full-length Plexin pcDNA3 plasmids using NEBuilder® HiFi DNA Assembly Master Mix (E2621S NEB), using the primers: pGex-GSTcytoPlexinB1: ATCGGATCTGGTTCCGCGTGGCAGGAGGAAGAGCAAGCAG and GTCAGTCACGA TGCGGCCGCTCCTATAGATCTGTGACCTTGTTTTC; pGex-GST-cytoPlexinB2: ATCGGATCTGG TTCCGCGTGGGTGCTACTGGAGG AAGAGC and GTCA GTCACGATGCGGCCGCTCAGTGAC CTTGTTCTCCAG; pGex-GST-cytoPlexinB3: ATCGGATCTGGTTCCGCGTGGGAGGCACAAGA GCAAGCAG and GTCA GTCACGATGCGGCCGCTCTCACAGGTCAGTCACTTTG. ..



    Similar Products

    91
    Addgene inc dr yi zhang
    Dr Yi Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yi+zhang/pcDNA-Flag-Tet3+(Plasmid+%2360940)/pmc12310658-89-11-15
    Average 91 stars, based on 1 article reviews
    dr yi zhang - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    93
    Addgene inc yi zhang
    Yi Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yi+zhang/pcDNA3-Tet1+(Plasmid+%2360938)/pm38862540-306-31-33
    Average 93 stars, based on 1 article reviews
    yi zhang - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    86
    Chongqing Key goldfish carassius auratus xiao yi zhang
    Fig. 1. Thelohanellus pseudonikolskii n. sp. and Myxobolus koi (Kudo, 1920) infecting fins and gills of goldfish <t>Carassius</t> <t>auratus</t> (Linnaeus, 1758), respectively. a: Plasmodia (arrows) of T. pseudonikolskii n. sp. in fins of goldfish; b: Plasmodia (arrows) of M. koi in gills of goldfish; c: Spores of T. pseudonikolskii n. sp.; d: Spores of M. koi.
    Goldfish Carassius Auratus Xiao Yi Zhang, supplied by Chongqing Key, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yi+zhang/auratus+carassius+goldfish+xiao+yi+zhang/10__1016_slash_j__aqrep__2022__101167-16-12-47
    Average 86 stars, based on 1 article reviews
    goldfish carassius auratus xiao yi zhang - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 1. Thelohanellus pseudonikolskii n. sp. and Myxobolus koi (Kudo, 1920) infecting fins and gills of goldfish Carassius auratus (Linnaeus, 1758), respectively. a: Plasmodia (arrows) of T. pseudonikolskii n. sp. in fins of goldfish; b: Plasmodia (arrows) of M. koi in gills of goldfish; c: Spores of T. pseudonikolskii n. sp.; d: Spores of M. koi.

    Journal: Aquaculture Reports

    Article Title: Identification of Thelohanellus pseudonikolskii n. sp. and Myxobolus koi Kudo, 1920 from goldfish Carassius auratus

    doi: 10.1016/j.aqrep.2022.101167

    Figure Lengend Snippet: Fig. 1. Thelohanellus pseudonikolskii n. sp. and Myxobolus koi (Kudo, 1920) infecting fins and gills of goldfish Carassius auratus (Linnaeus, 1758), respectively. a: Plasmodia (arrows) of T. pseudonikolskii n. sp. in fins of goldfish; b: Plasmodia (arrows) of M. koi in gills of goldfish; c: Spores of T. pseudonikolskii n. sp.; d: Spores of M. koi.

    Article Snippet: Identification of Thelohanellus pseudonikolskii n. sp. and Myxobolus koi Kudo, 1920 from goldfish Carassius auratus Xiao Yi Zhang a,1, Xin Yao a,1, Fan Zhou a, Cheng Zhong Yang b, Yang Liu a,* a School of Marine Science and Engineering, Qingdao Agricultural University, Qingdao, Shandong 266237, China b Chongqing Key Laboratory of Animal Biology, College of Life Sciences, Chongqing Normal University, Chongqing 401331, China A R T I C L E I N F O Keywords: Myxosporeans Ornamental fish Host shift Cyprinus carpio SSU rDNA A B S T R A C T During a parasitological survey of goldfish Carassius auratus (Linnaeus, 1758) in China, two myxosporeans were collected in the present study including a Thelohanellus species and a Myxobolus species.

    Techniques:

    Fig. 3. Histological analysis of Myxobolus koi (Kudo, 1920) infecting gills of goldfish Carassius auratus (Linnaeus, 1758). a: The gathered plasmodia (P) developing in stratified epithelium of filament in close contact with the cartilaginous gill ray and artery of the filament and the single plasmodium (P) developing in lamellae; b: the gathered plasmodia (P) segregated by thin fibrovascular septa; c: the plasmodium (P) filled with mature spores and some late developmental stages.

    Journal: Aquaculture Reports

    Article Title: Identification of Thelohanellus pseudonikolskii n. sp. and Myxobolus koi Kudo, 1920 from goldfish Carassius auratus

    doi: 10.1016/j.aqrep.2022.101167

    Figure Lengend Snippet: Fig. 3. Histological analysis of Myxobolus koi (Kudo, 1920) infecting gills of goldfish Carassius auratus (Linnaeus, 1758). a: The gathered plasmodia (P) developing in stratified epithelium of filament in close contact with the cartilaginous gill ray and artery of the filament and the single plasmodium (P) developing in lamellae; b: the gathered plasmodia (P) segregated by thin fibrovascular septa; c: the plasmodium (P) filled with mature spores and some late developmental stages.

    Article Snippet: Identification of Thelohanellus pseudonikolskii n. sp. and Myxobolus koi Kudo, 1920 from goldfish Carassius auratus Xiao Yi Zhang a,1, Xin Yao a,1, Fan Zhou a, Cheng Zhong Yang b, Yang Liu a,* a School of Marine Science and Engineering, Qingdao Agricultural University, Qingdao, Shandong 266237, China b Chongqing Key Laboratory of Animal Biology, College of Life Sciences, Chongqing Normal University, Chongqing 401331, China A R T I C L E I N F O Keywords: Myxosporeans Ornamental fish Host shift Cyprinus carpio SSU rDNA A B S T R A C T During a parasitological survey of goldfish Carassius auratus (Linnaeus, 1758) in China, two myxosporeans were collected in the present study including a Thelohanellus species and a Myxobolus species.

    Techniques: